FiltersDone

Question type

Essay

Multiple Choice

Short Answer

True False

Matching

Exam 12: Genomes

Show Answer

Share

---

All types

Filters

Study FlashcardsPractice ExamLearn

Question 21

Multiple Choice

Review LaterAdd Note

Review Later

DNA fingerprinting most often is based on

A) SNPs.
B) open reading frames.
C) telomeres.
D) repetitive DNA.
E) transposons.

Correct Answer

verified

Show Answer

Question 22

Multiple Choice

Review LaterAdd Note

Review Later

Which statement would be considered an expression of genetic determinism?

A) The proteome is more complex than the genome.
B) All people who are homozygous for the sickle-cell allele have sickle-cell disease.
C) Studying genes provides a limited understanding of what is going on in the cell.
D) The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes.
E) High levels of glucose may be an indicator of coronary heart disease.

Correct Answer

verified

Show Answer

Question 23

Multiple Choice

Review LaterAdd Note

Rank the following in terms of their relationship to the phenotypic characteristics of a cell or organism (from closest to most distant) : the genome,the proteome,and the metabolome.

Use the following to answer questions : The hypothetical anti-anxiety drug Epitome is inactive when taken,but it is activated by the rasputin enzyme a few hours after injection.Alleles 1 and 2 of the gene that encodes rasputin have similar activity levels.Individuals with one or both copies of allele 3,which is very rare,have much higher levels of enzyme activity.Individuals who have both copies of allele 4 have much lower levels of enzyme activity.Heterozygotes of allele 4 have normal levels of enzyme activity. -The Epitome drug would be most likely to be ineffective in individuals whose genotype has one copy of allele _______ and one copy of allele _______.

Which DNA sequence would be the most difficult to assemble?

Studies of the relative efficacy or nonefficacy of a drug based on specific genotypes would be considered part of the field of

Two-dimensional gel electrophoresis separates proteins based on _______ and _______.

Haplotype maps are based primarily on

Which statement about the globin genes in humans is false?

Craig Venter,a leader of one of the teams that sequenced the human genome,has now turned his attention to cataloging the microbial life of the oceans.His studies,which involve PCR amplification of microbial DNA and a sequencing of the PCR products,are part of a field of biology called

Which genome is most likely that of a free-living prokaryote?

Approximately how many Mycoplasma genitalium genomes would be equivalent to the haploid human genome (in terms of base pairs) ?

The gene most responsible for differences in size among different breeds of dogs is the _______ gene.

The closest living relatives to humans are _______,followed next by _______.

Which statement about eukaryotic genomes as compared with prokaryotic genomes is false?

Which statement about the human genome is true?

Which of the following is a major difference between LINEs and SINEs?

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA (2) CGTACATCTGAGGGTACGATCATGGC (3) CATGGCTAGCAAACGCGATCCCAAG (4) AGGCTAGTTACGATATAGGGGCC What is the correct order of these fragments?

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?