Filters
Question type

Study Flashcards

Red blood cells go through some special modifications as they mature.As a final step,the cells lose their nucleus.Which of the following is a likely consequence?


A) Red blood cells have extra genes not found in other cells.
B) Red blood cells have less DNA than other cells.
C) Red blood cells have less carbohydrate than other cells.
D) Red blood cells have more DNA than other cells.
E) Red blood cells are larger than most other cells.

Correct Answer

verifed

verified

DNA is made of the following nucleotide bases,EXCEPT


A) adenine.
B) guanine.
C) phosphate.
D) cytosine.
E) thymine.

Correct Answer

verifed

verified

C

Whose DNA will be most similar to Bob's? Arrange them in order,from most similar to least similar: mother,sibling,grandfather,identical twin.


A) identical twin,mother,sibling,grandfather
B) grandfather,sibling,mother,identical twin
C) mother,sibling,identical twin,grandfather
D) identical twin,sibling,grandfather,mother
E) none of the above

Correct Answer

verifed

verified

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12: Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC Bob: TTCGTTCCCAGCTAGCTTAACCGGC Which of the following accurately compares Mary and Bob's DNA?


A) Mary and Bob are most likely fraternal twins.
B) Mary has five STRs at this site;Bob has two.
C) Mary has one STR at this site;Bob has none.
D) The DNA shown must be from the 23rd chromosome,not the 12th.
E) None of the above.

Correct Answer

verifed

verified

Which of the following is a nucleotide?


A) polymerase
B) guanine
C) phosphate
D) DNA
E) STR region

Correct Answer

verifed

verified

DNA can be visualized as a ladder.Which parts would be the rungs (where you step) and which would be the stringers (the sides where you hold on) ?


A) The sugars and bases are rungs,and the phosphates are stringers.
B) The phosphates and bases are rungs,and the sugars are stringers.
C) The H-bonded sugars are rungs,and the phosphate bases are stringers.
D) The bases are rungs,and the sugars and phosphates are stringers.
E) The bases are the rungs,and the sugars the stringers.

Correct Answer

verifed

verified

How many STRs are typically used to create a profile in forensic investigations?


A) 10
B) 2
C) 5
D) 15
E) 25

Correct Answer

verifed

verified

D

The gel at right shows the DNA profiles for several individuals.If A is the mother and B is the father,which one of the others could be their child? The gel at right shows the DNA profiles for several individuals.If A is the mother and B is the father,which one of the others could be their child?   A)  C B)  D C)  E D)  C,D,and E E)  None of the above.


A) C
B) D
C) E
D) C,D,and E
E) None of the above.

Correct Answer

verifed

verified

STRs are


A) found only on chromosome 7.
B) in the coding regions only of all chromosomes.
C) the same on every chromosome.
D) in the noncoding regions of all chromosomes.
E) in the noncoding regions of some chromosomes.

Correct Answer

verifed

verified

Some highly degraded DNA was collected from a crime scene.Upon analysis,forensic scientists were only able to accurately sequence one 450-nucleotide-long segment of DNA from a Y chromosome.There are five suspects in the case,but they have fled the state.However,they all have large extended families in the area.How can the police narrow the search to just one suspect?


A) Collect DNA from male siblings,fathers,or paternal grandfathers.
B) Collect DNA from sisters,mothers,and maternal grandmothers.
C) Collect DNA from any male relatives on the mother's or father's side.
D) Collect DNA from any female relatives on the mother's or father's side.
E) Collect DNA from any available blood relatives of any gender.

Correct Answer

verifed

verified

Identify the correct nucleotide base pairing.


A) A-C;G-T
B) A-G;C-T
C) A-T;G-C
D) A-A;T-T
E) A-G;A-C

Correct Answer

verifed

verified

In addition to the base,what are the other components of a nucleotide?


A) sugar and polymerase
B) phosphate group and sugar
C) phosphate group and polymerase
D) phosphate group and helix
E) helix and sugar

Correct Answer

verifed

verified

What is the significance of STRs in DNA profiling?


A) STRs vary among different tissues within an individual,so they can be used to determine which organ was the source of the DNA.
B) STRs are inherited from only maternal DNA and can track parentage.
C) STRs are inherited from only paternal DNA and can track parentage.
D) STRs vary in length from person to person,which helps to identify specific individuals.
E) STRs code for proteins,therefore they are highly variable among individuals and can help to identify specific individuals.

Correct Answer

verifed

verified

Which person would have DNA that is least similar to yours?


A) your mother
B) your mother's brother
C) your older sibling
D) your identical twin
E) your nonidentical twin

Correct Answer

verifed

verified

How is the structure of a DNA molecule arranged?


A) Each nucleotide's phosphate group binds to the corresponding phosphate group of another nucleotide.
B) Each nucleotide's sugar group binds to the corresponding sugar group of another nucleotide.
C) Each nucleotide's phosphate group binds to the sugar group of the next nucleotide.
D) Each nucleotide's base binds to the next nucleotide base.
E) Each nucleotide's base binds to the phosphate group of another nucleotide.

Correct Answer

verifed

verified

The width (diameter) of the DNA helix normally varies a lot,depending on which bases are paired together at that location.


A) True
B) False

Correct Answer

verifed

verified

You are hired as a research assistant to help determine the genome of a wild onion plant.At the end of this project,you expect to have the


A) sequence of all of its genes.
B) sequence of all of its DNA.
C) sequence of all of its proteins.
D) total amount of RNA,DNA,and protein in its cells.
E) number of chromosomes in its nucleus.

Correct Answer

verifed

verified

DNA evidence can give an investigator information regarding which of the following?


A) family relationships between suspects
B) identity of an individual based on a profile
C) locations of an individual
D) family relationships between suspects and the locations of an individual
E) family relationships between suspects and the identity of an individual based on a profile

Correct Answer

verifed

verified

What is meant by "semiconservative" replication?


A) As the new strands of DNA are formed,the old strands are broken down and recycled.
B) As the new strands of DNA are formed,one of the old strands is broken down and recycled while the other is used as a template for the creation of a new strand.
C) The original strands of DNA are used to make newer strands,resulting in two copies of the DNA,one made entirely of new DNA,the other entirely of old DNA.
D) As DNA replication occurs,two new strands of DNA are produced without use of the original strands.
E) Each newly replicated strand of DNA consists of one original strand and one newly formed strand.

Correct Answer

verifed

verified

E

What naturally occurring process does PCR mimic in a test tube?


A) DNA condensation
B) transcription
C) genomics
D) DNA replication
E) polymerization

Correct Answer

verifed

verified

Showing 1 - 20 of 137

Related Exams

Show Answer