Question 1

The scientist(s) ________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

Accepted Answer

A)   Garrod 
B)   Nirenberg and Matthaei
C)   Khorana and colleagues
D)   Nirenberg and Leder
E)   Beadle and Tatum

Question 2

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

Accepted Answer

A) True 
 B)False

Question 3

Where are the ribosomal subunits assembled?

Accepted Answer

A)   nucleus
B)   nucleoid
C)   nucleolus
D)   nuclear envelope

Question 4

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Accepted Answer

A) True 
 B)False

Question 5

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Accepted Answer

A)   A
B)   E
C)   P

Question 6

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

Accepted Answer

A)   8
B)   9
C)   10
D)   11

Question 7

Which molecule contains an anticodon?

Accepted Answer

A)   DNA
B)   mRNA
C)   rRNA
D)   tRNA
E)   snRNA

Question 8

61 different tRNAs are required for translation in vivo.

Accepted Answer

A) True 
 B)False

Question 9

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

Accepted Answer

A)   Alternative splicing allows one gene to encode multiple polypeptides.
B)   Some genes encode RNAs, not enzymes.
C)   Some genes encode lipids, not enzymes.
D)   Some genes encode polypeptides that are not enzymes, such as structural proteins.
E)   Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.

Question 10

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Accepted Answer

A) True 
 B)False

Question 11

The wobble base is the second base of a codon.

Accepted Answer

A) True 
 B)False

Question 12

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Accepted Answer

A)   1
B)   2
C)   3
D)   4

Exam 15: Translation of MRNA

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Correct Answer
verified

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

Correct Answer
verified

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

Correct Answer
verified

The wobble base is the second base of a codon.

Correct Answer
verified

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Correct Answer
verified

The scientist(s) ________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

Correct Answer
verified

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Correct Answer
verified

61 different tRNAs are required for translation in vivo.

Correct Answer
verified

Where are the ribosomal subunits assembled?

Correct Answer
verified

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

Correct Answer
verified

Which molecule contains an anticodon?

Correct Answer
verified

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Correct Answer
verified

Exam 15: Translation of MRNA

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Correct AnswerverifiedShow Answer

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

Correct AnswerverifiedShow Answer

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

Correct AnswerverifiedShow Answer

The wobble base is the second base of a codon.

Correct AnswerverifiedShow Answer

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Correct AnswerverifiedShow Answer

The scientist(s) ________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

Correct AnswerverifiedShow Answer

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Correct AnswerverifiedShow Answer

61 different tRNAs are required for translation in vivo.

Correct AnswerverifiedShow Answer

Where are the ribosomal subunits assembled?

Correct AnswerverifiedShow Answer

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

Correct AnswerverifiedShow Answer

Which molecule contains an anticodon?

Correct AnswerverifiedShow Answer

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Correct AnswerverifiedShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified